Patent US3201720A successfully refreshed from Google Patents.
Patent US5217879A successfully refreshed from Google Patents.
US5217879A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Infectious Sindbis virus vectors
Assignee: Washington University in St. Louis
•
Filing: 1991-12-27
•
Granted: 1993-06-08
•
Expires: 2011-12-27
Abstract
Abstract Compositions and methods are disclosed for expressing heterologous coding sequences in host cells. The compositions include infectious Sindbis virus RNA molecules containing at least one heterologous coding sequence inserted within the structural region of the Sindbis virus genome. RNA molecules consisting essentially of a Sindbis virus junction region are also provided. Methods utilizing the novel compositions of the present invention to express heterologous coding sequences in transformed host cells are provided. Methods for producing infectious Sindbis virus particles containing infectious Sindbis virus RNA molecules comprising at least one heterologous coding sequence are provided.
Inventors
- 👤 Henry V. Huang
- 👤 Robin Levis
- 👤 Charles M. Rice
- 👤 Sondra Schlesinger
- 👤 Ping Shen
- 👤 Cheng Xiong
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-11-07 13:03
CPC Classifications
C; C12; C12N; C12N15/00; C12N15/09; C12N15/63; C12N15/79; C12N15/85; C12N15/86; C12N2760/00; C12N2760/00011; C12N2760/18011; C12N2760/18811; C12N2760/18841; C12N2760/18843
Claims Analysis
Total Claims: 34
Claim 1
Independent Claim
59 words
A self-replicating and self-packaging recombinant Sindbis virus RNA molecule which comprises a heterologous coding sequence located upstream from the virus structural coding region and at least five nucleotides downstream from the start of the Sindbis virus subgenomic RNA, and a Sindbis virus junction region located upstream form the virus structural coding region and downstream form the heterologous coding sequence.
Claim 2
Dependent Claim
59 words
A self-replicating and self-packaging recombinant Sindbis virus RNA molecule which comprises a heterologous coding sequence located upstream from the virus structural coding region and at least five nucleotides downstream from the start of the Sindbis virus subgenomic RNA, and a Sindbis virus junction region located upstream form the virus structural coding region and downstream form the heterologous coding sequence.
Claim 3
Dependent Claim
22 words
The Sindbis virus RNA molecule of claim 1, wherein the heterologous coding sequence encodes a protein of less than about 25 kilodaltons.
Claim 4
Dependent Claim
31 words
The Sindbis virus RNA molecule of claim 2 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5'-end to the 3'-end of said sequence: AUCUCUACGGUGGUCCUAAAUAGU
Claim 5
Dependent Claim
31 words
The Sindbis virus RNA molecule of claim 2 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5'-end to the 3'-end of said sequence: ##STR4##
Claim 6
Dependent Claim
31 words
The Sindbis virus RNA molecule of claim 2 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5'-end to the 3'-end of said sequence: ##STR5##
Claim 7
Dependent Claim
21 words
The Sindbis virus RNA molecule of claim 1 wherein the heterologous coding sequence is less than about 650 nucleotides in length.
Claim 8
Dependent Claim
33 words
The Sindbis virus RNA molecule of claim 6 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5' end to the 3' end of said sequence: AUCUCUACGGUGGUCCUAAAUAGU.
Claim 9
Dependent Claim
33 words
The Sindbis virus RNA molecule of claim 6 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5' end o the 3' end of said sequence: ##STR6##
Claim 10
Dependent Claim
33 words
The Sindbis virus RNA molecule of claim 6 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5' end to the 3' end of said sequence: ##STR7##
Claim 11
Dependent Claim
19 words
A DNA molecule which comprises DNA sequences encoding a Sindbis virus RNA molecule of claim 1, 2 or 6.
Claim 12
Dependent Claim
12 words
The DNA molecule of claim 10 wherein said DNA molecule is TotoCAT1.
Claim 13
Dependent Claim
41 words
A self-replicating and self-packaging recombinant Sindbis virus RNA molecule which comprises a heterologous coding sequence located downstream from the virus structural coding region and upstream from the first about 19 nucleotides immediately adjacent to and upstream from the viral polyA sequence.
Claim 14
Dependent Claim
41 words
A self-replicating and self-packaging recombinant Sindbis virus RNA molecule which comprises a heterologous coding sequence located downstream from the virus structural coding region and upstream from the first about 19 nucleotides immediately adjacent to and upstream from the viral polyA sequence.
Claim 15
Dependent Claim
34 words
The Sindbis virus RNA molecule of claim 12 wherein the heterologous coding sequence comprises a Sindbis virus junction region followed by an RNA sequence encoding a heterologous peptide of less than about 25 kilodaltons.
Claim 16
Dependent Claim
31 words
The Sindbis virus RNA molecule of claim 13 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5'-end to the 3'-end of said sequence: AUCUCUACGGUGGUCCUAAAUAGU
Claim 17
Dependent Claim
31 words
The Sindbis virus RNA molecule of claim 13 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5'-end to the 3'-end of said sequence: ##STR8##
Claim 18
Dependent Claim
31 words
The Sindbis virus RNA molecule of claim 13 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5'-end to the 3'-end of said sequence: ##STR9##
Claim 19
Dependent Claim
32 words
The Sindbis virus RNA molecule of claim 12 wherein the heterologous coding sequence comprises a Sindbis virus junction region followed by an RNA sequence of less than about 650 nucleotides in length.
Claim 20
Dependent Claim
33 words
The Sindbis virus RNA molecule of claim 17 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5' end to the 3' end of said sequence: AUCUCUACGGUGGUCCUAAAUAGU.
Claim 21
Dependent Claim
33 words
The Sindbis virus RNA molecule of claim 17 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5' end to the 3' end of said sequence: ##STR10##
Claim 22
Dependent Claim
33 words
The Sindbis virus RNA molecule of claim 17 wherein the Sindbis virus junction region comprises the following sequence of nucleotides, reading from the 5' end to the 3' end of said sequence: ##STR11##
Claim 23
Dependent Claim
19 words
A DNA molecule which comprises DNA sequences encoding a Sindbis virus RNA molecule of claim 12, 13 or 17.
Claim 24
Dependent Claim
12 words
The DNA molecule of claim 21 wherein the DNA molecule is Toto2J1.
Claim 25
Dependent Claim
33 words
An infectious Sindbis virus particle containing a recombinant Sindbis virus RNA molecule of claim 1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
Claim 26
Dependent Claim
31 words
A transformed eucaryotic cell comprising a Sindbis virus RNA molecule of claim 1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
Claim 27
Dependent Claim
20 words
The eucaryotic cell of claim 24 wherein said cell is selected from the group of avian, insect and mammalian cells.
Claim 28
Dependent Claim
13 words
The eucaryotic cell of claim 25 wherein said cell is an avian cell.
Claim 29
Dependent Claim
63 words
A method for expressing a heterologous coding sequence in an eucaryotic host cell, comprising transfecting the host cell with the Sindbis virus RNA molecule of claim 1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, or 20, and then growing the transfected host cell under conditions which allow for expression of the heterologous coding sequence.
Claim 30
Dependent Claim
21 words
The method of claim 27 wherein the host cell is selected from the group consisting of avian, insect and mammalian cells.
Claim 31
Dependent Claim
13 words
The method of claim 28 wherein the host cell is an avian cell.
Claim 32
Dependent Claim
21 words
The method of claim 27 further comprising the step of recovering infectious Sindbis virus particles produced by the transfected host cell.
Claim 33
Dependent Claim
21 words
The method of claim 30 wherein the host cell is selected form the group consisting of avian, insect and mammalian cells.
Claim 34
Dependent Claim
13 words
The method of claim 31 wherein the host cell is an avian cell.
References Cited (Backward Citations)
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 1996-06-07 | 1996-12-07 | 1997-06-08 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 2000-06-07 | 2000-12-07 | 2001-06-08 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 2004-06-07 | 2004-12-07 | 2005-06-08 | $7700.00 | Window Closed / Lapsed |