Patent US2086324A successfully refreshed from Google Patents.
Patent US3359841A successfully refreshed from Google Patents.
Patent US2027063A successfully refreshed from Google Patents.
Patent US5122459A successfully refreshed from Google Patents.
US5122459A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Gene encoding biologically active human interleukin 1
Assignee: Cistron Biotechnology Inc
•
Filing: 1989-11-30
•
Granted: 1992-06-16
•
Expires: 2009-11-30
Abstract
Abstract Double-stranded cDNA is prepared from polyadenylated RNA extracted from activated human peripheral blood adherent mononuclear cells. The cDNA is inserted within a plasmid vector and then the recombinant plasmid employed to transform an appropriate host. Transformed hosts are identified and grouped into pools. Plasmid DNA prepared from these pools is hybridized with a labeled, synthetic oligonucleotide probe corresponding to a portion of the amino acid sequence of the interleukin 1 protein. Pools of host cells that provide a positive signal to the probe are identified, plated out and then employed in direct bacterial colony hybridization with the same probe, thereby to isolate the particular positive colony. Plasmid DNA is prepared from this colony and characterized by restriction enzyme mapping and sequencing by chain-termination method. The coding region for the IL-1 gene is inserted into a shuttle vector for amplification of the vector followed by expression of functional IL-1.
Inventors
- 👤 Paul J. Conlon, III
- 👤 David J. Cosman
- 👤 Kenneth H. Grabstein
- 👤 Thomas P. Hopp
- 👤 Shirley R. Kronheim
- 👤 Alf D. Larsen
- 👤 Carl J. March
- 👤 Virginia L. Price
- 👤 Douglas P. Cerretti
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-11-04 21:05
CPC Classifications
C; C07; C07K; C07K14/00; C07K14/435; C07K14/52; C07K14/54; C07K14/545; C12; C12N; C12N15/00; C12N15/09; C12N15/63; C12N15/79; C12N15/80; C12N15/81; Y; Y10; Y10S; Y10S435/00; Y10S435/8215; Y10S435/911; Y10S435/94; Y10S435/942
Claims Analysis
Total Claims: 12
Claim 1
Independent Claim
94 words
An isolated, double-stranded DNA molecule comprising a DNA sequence encoding a translation product that displays human IL-1 β activity in the thymocyte proliferation assay wherein one strand of said molecule hybridizes to an oligonucleotide probe after overnight hybridization at about 50° C. in 6×SSC solution and washing a room temperature with 6×SSC solution followed by washing at 50° C. in 6×SSC, and wherein (1) said probe comprises the nucleotide sequence: ACTTGTTGTTCCATGTCTTGGCCTTGCAGGTGCAGGGCTTTCAGTTCGTAGGGGCCGGACAT; and (2) said translation product is approximately the 153 c-terminal amino acid residues of the amino acid sequence set forth in FIG. 2.
Claim 2
Dependent Claim
94 words
An isolated, double-stranded DNA molecule comprising a DNA sequence encoding a translation product that displays human IL-1 β activity in the thymocyte proliferation assay wherein one strand of said molecule hybridizes to an oligonucleotide probe after overnight hybridization at about 50° C. in 6×SSC solution and washing a room temperature with 6×SSC solution followed by washing at 50° C. in 6×SSC, and wherein (1) said probe comprises the nucleotide sequence: ACTTGTTGTTCCATGTCTTGGCCTTGCAGGTGCAGGGCTTTCAGTTCGTAGGGGCCGGACAT; and (2) said translation product is approximately the 153 c-terminal amino acid residues of the amino acid sequence set forth in FIG. 2.
Claim 3
Dependent Claim
15 words
An isolated DNA molecule according to claim 1, wherein said molecule is a cDNA molecule.
Claim 4
Dependent Claim
22 words
An isolated DNA molecule according to claim 1, wherein said DNA sequence comprises nucleotides No. 428 through No. 886 of FIG. 2.
Claim 5
Dependent Claim
31 words
An isolated DNA molecule according to claim 1, wherein said translation product consists of amino acid residues No. 1 through No. 153 in FIG. 2 and, optionally, an N-terminal methionine residue.
Claim 6
Dependent Claim
15 words
An isolated DNA molecule according to claim 1, wherein said molecule is a recombinant plasmid.
Claim 7
Dependent Claim
28 words
An isolated DNA molecule according to claim 5, wherein said recombinant plasmid is an expression plasmid capable of directing the translation of said polypeptide in a yeast cell.
Claim 8
Dependent Claim
12 words
A yeast cell transformed by an expression vector according to claim 6.
Claim 9
Dependent Claim
12 words
A yeast cell transformed by a recombinant plasmid according to claim 3.
Claim 10
Dependent Claim
16 words
A yeast cell according to claim 8, wherein said yeast cell is a S. cerevisiae cell.
Claim 11
Dependent Claim
65 words
A method for producing a polypeptide having biological activity in a thymocyte proliferation assay, said polypeptide consisting of amino acid residues No. 1 through No. 153 in FIG. 2 and, optionally, an N-terminal methionine residue, comprising the steps of (A) growing a recombinant yeast host cell according to claim 7 under conditions favorable for expression and recovery of said polypeptide; and (B) recovering said polypeptide.
Claim 12
Dependent Claim
15 words
A method according to claim 10, wherein said yeast cell is a Saccharomyces cerevisiae cell.
References Cited (Backward Citations)
GB2063882A
Cited
US4406830A
Cited
US4508833A
Cited
EP0092163A2
Cited
US4762914A
Cited
US4766069A
Cited
US5001057A
Cited
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 1995-06-16 | 1995-12-16 | 1996-06-16 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 1999-06-16 | 1999-12-16 | 2000-06-16 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 2003-06-16 | 2003-12-16 | 2004-06-16 | $7700.00 | Window Closed / Lapsed |