Patent US438529A successfully refreshed from Google Patents.
Patent US4332898A successfully refreshed from Google Patents.
US4332898A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Hybrid plasmid and process of making same
Assignee: Pharmacia and Upjohn Co
•
Filing: 1980-06-16
•
Granted: 1982-06-01
•
Expires: 2000-06-16
Abstract
Abstract A novel chemical compound, plasmid pUC1021, which was constructed from Bacillus megaterium chromosomal DNA and plasmid pBR322. Hybrid plasmid pUC1021 contains a functional tet gene promoter, and, thus, is useful as a cloning vehicle in recombinant DNA work. For example, using well known DNA methodology, a desired gene, for example, the insulin gene, can be inserted into pUC1021 and the resulting plasmid can then be transformed into a suitable host microbe which, upon culturing, produces the desired insulin.
Inventors
- 👤 Fritz Reusser
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-10-30 11:15
CPC Classifications
C; C12; C12N; C12N15/00; C12N15/09; C12N15/63; C12N15/70; C12N1/00; C12N1/20; C12N1/205; C12N15/74; C12N15/75; C12R; C12R2001/00; C12R2001/01; C12R2001/185; C12R2001/19; Y; Y10; Y10S; Y10S435/00; Y10S435/8215; Y10S435/822; Y10S435/848; Y10S435/849
Claims Analysis
Total Claims: 10
Claim 1
Independent Claim
11 words
E. coli HB101 (pUC1021) having the deposit accession number NRRL B-12167.
Claim 2
Dependent Claim
11 words
E. coli HB101 (pUC1021) having the deposit accession number NRRL B-12167.
Claim 3
Dependent Claim
89 words
Hybrid plasmid pUC1021 characterized as follows: (a) it is a hybrid plasmid which has the entire nucleotide sequence of plasmid pBR322 and a foreign DNA insert at the HindIII site of pBR322; (b) said DNA insert, and direction of insertion, being shown by the restriction map in the drawing; (c) said DNA insert being further characterized by (1) the following partial nucleotide sequence which is located between the two HindIII sites of pUC1021: CCGGGAAGTGAAGTCAGAGAAAAGGAAAAGTGCGAGAGGGAAGGAAAAGAGGGGA; (2) being 350 base pairs in length; and (3) having a single MboII restriction site.
Claim 4
Dependent Claim
89 words
Hybrid plasmid pUC1021 characterized as follows: (a) it is a hybrid plasmid which has the entire nucleotide sequence of plasmid pBR322 and a foreign DNA insert at the HindIII site of pBR322; (b) said DNA insert, and direction of insertion, being shown by the restriction map in the drawing; (c) said DNA insert being further characterized by (1) the following partial nucleotide sequence which is located between the two HindIII sites of pUC1021: CCGGGAAGTGAAGTCAGAGAAAAGGAAAAGTGCGAGAGGGAAGGAAAAGAGGGGA; (2) being 350 base pairs in length; and (3) having a single MboII restriction site.
Claim 5
Dependent Claim
61 words
A process for preparing hybrid plasmid pUC1021 which comprises: (a) linearizing plasmid pBR322 with HindIII to obtain linear plasmid DNA; (b) obtaining chromosomal DNA from Bacillus megaterium NRRL B-12165. (c) digesting said chromosomal DNA with HindIII, and (d) ligating said digested linear plasmid DNA from pBR322 and said digested chromosomal DNA from Bacillus megaterium, NRRL B-12165, to obtain hybrid plasmid pUC1021.
Claim 6
Dependent Claim
61 words
A process for preparing hybrid plasmid pUC1021 which comprises: (a) linearizing plasmid pBR322 with HindIII to obtain linear plasmid DNA; (b) obtaining chromosomal DNA from Bacillus megaterium NRRL B-12165. (c) digesting said chromosomal DNA with HindIII, and (d) ligating said digested linear plasmid DNA from pBR322 and said digested chromosomal DNA from Bacillus megaterium, NRRL B-12165, to obtain hybrid plasmid pUC1021.
Claim 7
Dependent Claim
12 words
A process for cloning plasmid pUC1021 into a suitable host by transformation.
Claim 8
Dependent Claim
12 words
A process for cloning plasmid pUC1021 into a suitable host by transformation.
Claim 9
Dependent Claim
13 words
A process, according to claim 4, wherein said suitable host is a bacterium.
Claim 10
Dependent Claim
13 words
A process, according to claim 5, wherein said bacterium is E. coli HB101.
References Cited (Backward Citations)
No citation records indexed.
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 1985-05-31 | 1985-11-30 | 1986-06-01 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 1989-05-31 | 1989-11-30 | 1990-06-01 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 1993-05-31 | 1993-11-30 | 1994-06-01 | $7700.00 | Window Closed / Lapsed |