Expression plasmids for improved production of heterologous protein in bacteria

Claim 2

A process for making an expression plasmid comprising the nucleotide sequence (a) TA A A AAGGAGAATTC ATG or (b) TAAAAAGGGTATCGAGAATTC ATG which comprises introducing into a pBR322 derived plasmid the nucleotide sequence (a) or (b).

Claim 3

A process for making an expression plasmid according to claim 1 wherein the nucleotide sequences are inserted into said pBR322 derived plasmid downstream from a transcriptional promoter sequence.

Claim 4

A process for making an expression plasmid according to claim 1 wherein a gene encoding for a heterologous protein is inserted into nucleotide sequence (a) or (b) at the EcoRI site thereof.

Claim 5

A process according to claim 3 wherein said gene encodes for prorennin or a mammalian growth hormone.

Claim 6

A process for making plasmid ptrpLI-R2 or plasmid ptrpLI-R4 which comprises (a) digesting ptrpLI with restriction endonuclease ClaI; (b) blunting the cohesive ends of the digestion product of step (a) in a reaction mixture containing dGTP and dCTP; (c) treating the step (b) product with Klenow fragment of DNA polymerase; (d) ligating the step (c) product with the synthetic linker (5' AGAATTCATGG 3') (3' TCTTAAGTACC 5'); (e) digesting the product of step (d) with restriction endonuclease EcoRI; (f) religating the EcoRI cleaved plasmid of step (e); (g) transforming E. coli HB101 with the ligation mixture of step (f); (h) preparing plasmid DNA from transformants of step (g) to afford plasmids ptrpLI-R2 and ptrpLI-R4.

Claim 7

A process for making plasmid ptrpLI-R2 or plasmid ptrpLI-R4 which comprises (a) digesting ptrpLI with restriction endonuclease ClaI; (b) blunting the cohesive ends of the digestion product of step (a) in a reaction mixture containing dGTP and dCTP; (c) treating the step (b) product with Klenow fragment of DNA polymerase; (d) ligating the step (c) product with the synthetic linker (5' AGAATTCATGG 3') (3' TCTTAAGTACC 5'); (e) digesting the product of step (d) with restriction endonuclease EcoRI; (f) religating the EcoRI cleaved plasmid of step (e); (g) transforming E. coli HB101 with the ligation mixture of step (f); (h) preparing plasmid DNA from transformants of step (g) to afford plasmids ptrpLI-R2 and ptrpLI-R4.

Claim 8

A process for making plasmid ptrpLI-R2-B48 or plasmid ptrpLI-R4-B48 which comprises inserting into the EcoRI sites of expression plasmids ptrpLI-R2 or ptrpLI-R4 the 40 bp sequence CATGGCTGAGATCACTAGGATCCTAGTGATCTCAGCCATG GTACCGACTCTAGTGATCCTAGGATCACTAGAGTCGGTAC

Claim 9

A process for making plasmid ptrpLI-R2-B48 or plasmid ptrpLI-R4-B48 which comprises inserting into the EcoRI sites of expression plasmids ptrpLI-R2 or ptrpLI-R4 the 40 bp sequence CATGGCTGAGATCACTAGGATCCTAGTGATCTCAGCCATG GTACCGACTCTAGTGATCCTAGGATCACTAGAGTCGGTAC

Claim 10

A process for making bacterial expression plasmids pBGH212-R2 and pBGH212-R4 which comprises (a) inserting into the EcoRI and HindIII sites of plasmid pBR322 the synthetic end of said bovine growth hormone as presented in Figure 5-1; (b) transforming E. coli with the plasmid thus produced and selecting ampicillin resistant plasmids to obtain a plasmid comprising said synthetic end of bovine growth hormone; (c) isolating from plasmid pBGHl02 the 490bp PvuII fragment encoding for amino acids 23 to 86; (d) ligating said DNA sequence to the 75 bp EcoRI-PvuII fragment isolated from.the plasmid of step (b); (e) cleaving the ligation mix of step (d) with restriction endonucleases EcoRI and PstI to afford a 270 bp fragment; (f) inserting said 270 bp fragment into the large fragment obtained by linearization of plasmid pBR322 with EcoRI and PstI to produce a new plasmid; (g) inserting into the PstI site of the plasmid of step (f) the 440 bp PstI DNA fragment from pBGH102 to obtain plasmid pBGH212; (h) cleaving plasmid gBGH212 with restriction endonuclease EcoRI and treating the cleavage product with bacterial alkaline phosphatse; (i) ligating the product of step (h) with the approximately 290 bp EcoRI DNA fragments containing the E. coli trp promoter and desired ribosome binding sites, said EcoRI fragments being obtained by EcoRI. cleavage of plasmid ptrpLI - R2 or plasmid ptrpLI-R4 to produce plasmids pBGH212-R2 and pBGH212-R4.

Claim 11

A process for making bacterial expression plasmids pBGH212-R2 and pBGH212-R4 which comprises (a) inserting into the EcoRI and HindIII sites of plasmid pBR322 the synthetic end of said bovine growth hormone as presented in Figure 5-1; (b) transforming E. coli with the plasmid thus produced and selecting ampicillin resistant plasmids to obtain a plasmid comprising said synthetic end of bovine growth hormone; (c) isolating from plasmid pBGHl02 the 490bp PvuII fragment encoding for amino acids 23 to 86; (d) ligating said DNA sequence to the 75 bp EcoRI-PvuII fragment isolated from.the plasmid of step (b); (e) cleaving the ligation mix of step (d) with restriction endonucleases EcoRI and PstI to afford a 270 bp fragment; (f) inserting said 270 bp fragment into the large fragment obtained by linearization of plasmid pBR322 with EcoRI and PstI to produce a new plasmid; (g) inserting into the PstI site of the plasmid of step (f) the 440 bp PstI DNA fragment from pBGH102 to obtain plasmid pBGH212; (h) cleaving plasmid gBGH212 with restriction endonuclease EcoRI and treating the cleavage product with bacterial alkaline phosphatse; (i) ligating the product of step (h) with the approximately 290 bp EcoRI DNA fragments containing the E. coli trp promoter and desired ribosome binding sites, said EcoRI fragments being obtained by EcoRI. cleavage of plasmid ptrpLI - R2 or plasmid ptrpLI-R4 to produce plasmids pBGH212-R2 and pBGH212-R4.

Claim 12

A process for making expression plasmids for bovine growth hormone production which comprises: (a) subjecting plasmids pBGH212-R2 or pBGH212-R4 to partial PvuII cleavage to produce approximately 920 bp fragments; (b) ligating said approximately 920 bp fragments with the 365 bp PvuII-EamHI DNA fragment obtained by PvuII and BamHI cleavage of a pBR322 derivative containing a synthetic 20 bp EcoRI-HindIII DNA fragment encoding the C-terminal end of bovine growth hormone, and the large 3995 b p fragment obtained by BamHI-HindIII cleavage of pBR322 to produce plasmids pBGH301 and pBGH375.

Claim 13

A process for making expression plasmids for bovine growth hormone production which comprises: (a) subjecting plasmids pBGH212-R2 or pBGH212-R4 to partial PvuII cleavage to produce approximately 920 bp fragments; (b) ligating said approximately 920 bp fragments with the 365 bp PvuII-EamHI DNA fragment obtained by PvuII and BamHI cleavage of a pBR322 derivative containing a synthetic 20 bp EcoRI-HindIII DNA fragment encoding the C-terminal end of bovine growth hormone, and the large 3995 b p fragment obtained by BamHI-HindIII cleavage of pBR322 to produce plasmids pBGH301 and pBGH375.

Claim 14

A process for making bacterial expression plasmids for porcine growth hormone which comprises: (a) cleaving plasmid pGH-24 with PstI and PvuII and isolating the 635 bp fragment thus produced; . (b) digesting said 635 bp fragment with RsaI and isolating the resulting 200 bp fragment and 480 bp fragment; (c) cleaving said 200 bp fragment with AsuI and isolating the resulting 75 bp fragment; (d) ligating said 75 bp fragment with the above-produced 480 bp fragment. and the 5 3 bp fragment obtained by AsuI cleavage of the 75 bp fragment produced by EcoRI-PvuII digestion of plasmid pGH-75; (e) digesting the ligation product of step (d) with EcoRI and PvuII and isolating from the resulting digestion mixture a 570 bp fragment; (f) ligating said 570 bp fragment with the 340 bp EcoRI partial PvuII digest fragment of plasmid pBGH-375 to produce a plasmid containing a 910 bp EcoRI-BamHI fragment; (g) linearizing the plasmid of step (f) by EcoRI, bacterial alkaline phosphatase treatment; (h) ligating the linearized product of step (g) with the approximately 400 bp EcoRI digestion product of pBGH-375 to produce plasmids pGH101 and pGH107.

Claim 15

A process for making bacterial expression plasmids for porcine growth hormone which comprises: (a) cleaving plasmid pGH-24 with PstI and PvuII and isolating the 635 bp fragment thus produced; . (b) digesting said 635 bp fragment with RsaI and isolating the resulting 200 bp fragment and 480 bp fragment; (c) cleaving said 200 bp fragment with AsuI and isolating the resulting 75 bp fragment; (d) ligating said 75 bp fragment with the above-produced 480 bp fragment. and the 5 3 bp fragment obtained by AsuI cleavage of the 75 bp fragment produced by EcoRI-PvuII digestion of plasmid pGH-75; (e) digesting the ligation product of step (d) with EcoRI and PvuII and isolating from the resulting digestion mixture a 570 bp fragment; (f) ligating said 570 bp fragment with the 340 bp EcoRI partial PvuII digest fragment of plasmid pBGH-375 to produce a plasmid containing a 910 bp EcoRI-BamHI fragment; (g) linearizing the plasmid of step (f) by EcoRI, bacterial alkaline phosphatase treatment; (h) ligating the linearized product of step (g) with the approximately 400 bp EcoRI digestion product of pBGH-375 to produce plasmids pGH101 and pGH107.

Claim 16

A process for efficient expression of heterologous proteins by E. coli which comprises introducing into said E..coli plasmids carrying an E. coli trp promoter - operator fragment, an ATG initiation codon, cDNA gene sequences encoding mammalian growth hormone or prorennin, and the ribosome binding site AAGGAGAATTC or AAGGGTATCGAGAATTC.

Claim 17

A process for efficient expression of heterologous proteins by E. coli which comprises introducing into said E..coli plasmids carrying an E. coli trp promoter - operator fragment, an ATG initiation codon, cDNA gene sequences encoding mammalian growth hormone or prorennin, and the ribosome binding site AAGGAGAATTC or AAGGGTATCGAGAATTC.

Claim 18

A process fo preparing plasmids pPFZ-R2 or pPFZ-R4 which comprises: (a) digesting.plasmid ptrpLI-R2-B48 or ptrpLI-R4-B48 with restriction endonucleases HindIII and . BamHI to obtain trp promoter containing fragments; (b) digesting plasmid pCR101 with restriction endonucleases HindIII and KpnI to obtain fragmented linear plasmid DNA; (c) isolating from step (b) the large vector fragment of 4772 bp and the small fragment of 906 bp; (d) further digesting said small fragment with restriction endonuclease BamHI to produce a BamHI- K pnI fragment of 235 bp; (e) ligating the fragment of steps (a) and (d) with the large vector fragment of step (c). to obtain plasmids pPFZ-R2 or pPFZ-R4.

Claim 19

A process fo preparing plasmids pPFZ-R2 or pPFZ-R4 which comprises: (a) digesting.plasmid ptrpLI-R2-B48 or ptrpLI-R4-B48 with restriction endonucleases HindIII and . BamHI to obtain trp promoter containing fragments; (b) digesting plasmid pCR101 with restriction endonucleases HindIII and KpnI to obtain fragmented linear plasmid DNA; (c) isolating from step (b) the large vector fragment of 4772 bp and the small fragment of 906 bp; (d) further digesting said small fragment with restriction endonuclease BamHI to produce a BamHI- K pnI fragment of 235 bp; (e) ligating the fragment of steps (a) and (d) with the large vector fragment of step (c). to obtain plasmids pPFZ-R2 or pPFZ-R4.

Claim 20

A process for preparing plasmid ptrpLI-R2 and ptrpLI-R4 which comprises (a) digesting plasmid ptrpLI with ClaI to obtain linear plasmid DNA; (b) treating said linear plasmid DNA with K lenow polymerase to obtain linear plasmid having blunt ends; (c) ligating said blunt ended linearized plasmid DNA from ptrpLI and the synthetic double strand EcoRI linker (i) 5' CCATGAATTCT 3' 3' GGTACTTAAGA 3' or (ii) 5' AGAATTCATGG 3' 3' TCT T AAGTACC 5' to obtain plasmids ptrpLI-R2 and ptrpLI-R4; (d) identifying said plasmids by determination of DNA sequences at linker junctions.

Claim 21

A process for preparing plasmid ptrpLI-R2 and ptrpLI-R4 which comprises (a) digesting plasmid ptrpLI with ClaI to obtain linear plasmid DNA; (b) treating said linear plasmid DNA with K lenow polymerase to obtain linear plasmid having blunt ends; (c) ligating said blunt ended linearized plasmid DNA from ptrpLI and the synthetic double strand EcoRI linker (i) 5' CCATGAATTCT 3' 3' GGTACTTAAGA 3' or (ii) 5' AGAATTCATGG 3' 3' TCT T AAGTACC 5' to obtain plasmids ptrpLI-R2 and ptrpLI-R4; (d) identifying said plasmids by determination of DNA sequences at linker junctions.

Claim 22

A process for preparing a transformant comprising one of plasmids pPFZ-R2, pPFZ-R4, pBGH212-R2, pBGH212-R4, pBGH301, pBGH375, pGH101, pGH107, PEGF-R2 or pEGF-R4 in E. coli which comprises transforming said E. coli with one of said plasmids.

Claim 23

A process for preparing a transformant comprising one of plasmids pPFZ-R2, pPFZ-R4, pBGH212-R2, pBGH212-R4, pBGH301, pBGH375, pGH101, pGH107, PEGF-R2 or pEGF-R4 in E. coli which comprises transforming said E. coli with one of said plasmids.

Claim 24

A process which comprises cultivating in an aqueous medium comprising an assimilable source of carbon, nitrogen and inorganic salts a microorganism comprising an E. coli-comprising a plasmid according to claim 13 until a substantial amount of bacterial produced protein is expressed.

Claim 25

A process according to claim 14 wherein said microorganism comprises E. coli comprising plasmid pPFZ-R2, pBGH-301, pGH107 or pEGF-R2.

Claim 26

A process which comprises cultivating in an aqueous medium comprising an assimilable source of carbon, nitrogen and inorganic salts a microorganism comprising an E. coli comprising a plasmid according to claim 1 until a substantial amount of bacterial produced protein is expressed.

Claim 27

A process for producing prorennin which comprises cultivating in an aqueous nutrient medium comprising an assimilable source of carbon, nitrogen and inorganic salts a microorganism comprising an E. coli K-12 strain comprising plasmid pPFZ-R2 or pPFZ-R4, said microorganisms having the identifying characteristics of ATCC-39544 and ATCC-39543, respectively, until substantial amounts of prorennin are expressed and isolating said prorennin-

Claim 28

A process for producing prorennin which comprises cultivating in an aqueous nutrient medium comprising an assimilable source of carbon, nitrogen and inorganic salts a microorganism comprising an E. coli K-12 strain comprising plasmid pPFZ-R2 or pPFZ-R4, said microorganisms having the identifying characteristics of ATCC-39544 and ATCC-39543, respectively, until substantial amounts of prorennin are expressed and isolating said prorennin-