US4634678A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Plasmid cloning and expression vectors for use in microorganisms
Assignee: Molecular Genetics Research and Development LP
•
Filing: 1982-12-13
•
Granted: 1987-01-06
•
Expires: 2002-12-13
Abstract
Abstract DNA cloning and expression vectors capable of replication in a microbial host comprising from upstream to downstream (a) at least one promoter; (b) a translation start codon; (c) a cloning segment which provides a means for inserting nucleic acid sequences and (d) a sequence coding for a detectable gene product, out of translational phase with the translation start codon but capable of being readjusted to the translational phase of said start codon by insertion into the cloning segment of nucleic acid sequences containing the proper number of nucleotides for readjustment, said gene product providing a means for detecting expression of inserted nucleic acid sequences.
Inventors
- 👤 John S. Salstrom
- 👤 Dawn Newman
- 👤 Douglas F. Harbrecht
- 👤 Shiu-Lok Hu
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-10-23 15:36
CPC Classifications
C; C12; C12N; C12N15/00; C12N15/09; C12N15/63; C12N15/67; C12N15/69; C12N15/70
Claims Analysis
Total Claims: 50
Claim 1
Independent Claim
93 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ and a λcro Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a cro gene amino terminus fragment. (e) a cloning segment; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an antibiotic resistance marker.
Claim 2
Dependent Claim
93 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ and a λcro Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a cro gene amino terminus fragment. (e) a cloning segment; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an antibiotic resistance marker.
Claim 3
Dependent Claim
33 words
The DNA cloning and expression vector of claim 1, named pJS413, wherein the cloning segment comprises a BglII site, a SmaI site and a BamHI site and is in the (+2) translational phase.
Claim 4
Dependent Claim
35 words
The DNA cloning and expression vector of claim 1, named pHK413, wherein the cloning segment comprises a BglII, a HindIII site, a SmaI site, and a BamHI site and is in the (+1) translational phase.
Claim 5
Dependent Claim
35 words
The DNA cloning and expression vector of claim 1, named pHK412, wherein the cloning segment comprises a BglII, a HindIII site, a SmaI site and a BamHI site and is in the (0) translational phase.
Claim 6
Dependent Claim
36 words
The DNA cloning and expression vector of claim 1, named pHK414, wherein the cloning segment comprises a BglII site, a HindIII site, a SmaI site and a BamHI site and is in the (+2) translational phase.
Claim 7
Dependent Claim
33 words
The DNA cloning and expression vector of claim 1, named pHK410, wherein the cloning segment comprises a BglII site, a HindIII site and a BamHI site and is in the (0) translational phase.
Claim 8
Dependent Claim
33 words
The DNA cloning and expression vector of claim 1, named pHK411, wherein the cloning segment comprises a BgIII site, a HindIII site and a BamHI site and is in the (+1) translational phase.
Claim 9
Dependent Claim
37 words
The DNA cloning and expression vector of a claim 1, named pHK420, wherein the cloning segment comprises a BgIII site, a HindIII site, a SmaI site and a BamHI site and is in the (0) translational phase.
Claim 10
Dependent Claim
36 words
The DNA cloning and expression vector of claim 1, named pHK422, wherein the cloning segment comprises a BglII site, a HindIII site, a SmaI site and a BamHI site and is in the (+2) translational phase.
Claim 11
Dependent Claim
49 words
The DNA cloning and expression vector of claim 1, named pSH113, wherein the cloning segment comprises a BglII site, a SmaI site and a BamHI site and is in the (+2) translational phase, further comprising an origin bearing the OPlΔ6 colEl mutation to provide for increased vector copy number.
Claim 12
Dependent Claim
43 words
The DNA cloning and expression vector of claim 1, named pDN413RI - , wherein the cloning segment comprises a BglII site and a BamHI site and is in the (0) translational phase, further comprising a unique EcoRI site upstream of the Plac promoter.
Claim 13
Dependent Claim
101 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ and a λcro Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a cro gene amino-terminal fragment, which fragment has been partially deleted by nuclease treatment; (e) a cloning segment; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an antibiotic resistance marker.
Claim 14
Dependent Claim
101 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ and a λcro Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a cro gene amino-terminal fragment, which fragment has been partially deleted by nuclease treatment; (e) a cloning segment; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an antibiotic resistance marker.
Claim 15
Dependent Claim
91 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a lacZ gene amino-terminal fragment, (e) a cloning segment comprising an EcoRI site, a SmaI site and a BamHI site; (f) a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 16
Dependent Claim
91 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a lacZ gene amino-terminal fragment, (e) a cloning segment comprising an EcoRI site, a SmaI site and a BamHI site; (f) a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 17
Dependent Claim
18 words
The DNA cloning and expression vector of claim 13, named pMG101, which is in the (+2) translational phase.
Claim 18
Dependent Claim
97 words
A DNA cloning and expression vector, named pJSIIIb, capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by lacZ gene amino-terminal fragment; (e) a cloning segment comprising an EcoRI site and a BamHI site, which segment is in the (0) translational phase; (f) a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 19
Dependent Claim
97 words
A DNA cloning and expression vector, named pJSIIIb, capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by lacZ gene amino-terminal fragment; (e) a cloning segment comprising an EcoRI site and a BamHI site, which segment is in the (0) translational phase; (f) a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 20
Dependent Claim
99 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a lacZ gene amino-terminus fragment; (e) a cloning segment comprising an EcoRI site, a SmaI site and a BamHI site; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 21
Dependent Claim
99 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a lacZ gene amino-terminus fragment; (e) a cloning segment comprising an EcoRI site, a SmaI site and a BamHI site; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 22
Dependent Claim
18 words
The DNA cloning and expression vector of claim 16, named pJS400, which is in the (+1) translational phase.
Claim 23
Dependent Claim
106 words
A DNA cloning and expression vector, named pDN400, capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a lacZ gene amino-terminus fragment; (e) a cloning segment comprising an EcoRI site and a BamHI site, which segment is in the (0) translational phase; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 24
Dependent Claim
106 words
A DNA cloning and expression vector, named pDN400, capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a Plac promoter; (b) an Olac operator; (c) a lacZ Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a lacZ gene amino-terminus fragment; (e) a cloning segment comprising an EcoRI site and a BamHI site, which segment is in the (0) translational phase; (f) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 25
Dependent Claim
100 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λcI857 regulatory gene coding for a repressor; (b) a λP R promoter; (c) a λO R operator; (d) a λcro Shine-Dalgarno nucleotide sequence; (e) a translation start codon encoded by a cro gene amino-terminal fragment; (f) a cloning segment; (g) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (h) an antibiotic resistance marker.
Claim 26
Dependent Claim
100 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λcI857 regulatory gene coding for a repressor; (b) a λP R promoter; (c) a λO R operator; (d) a λcro Shine-Dalgarno nucleotide sequence; (e) a translation start codon encoded by a cro gene amino-terminal fragment; (f) a cloning segment; (g) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (h) an antibiotic resistance marker.
Claim 27
Dependent Claim
33 words
The DNA cloning and expression vector of claim 19, named pDN455, wherein the cloning segment comprises a BgIII site, a SmaI site, and a BamHI site, and is in the (+2) translational phase.
Claim 28
Dependent Claim
26 words
The DNA cloning and expression vector of claim 19, named pDN456, wherein the cloning segment comprises a BgIII site, and is in the (0) translational phase.
Claim 29
Dependent Claim
25 words
The DNA cloning and expression vector of claim 19 in which the λcro gene amino-terminal fragment has been partially or totally deleted by nuclease treatment.
Claim 30
Dependent Claim
87 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λP L promoter; (b) a λO L operator; (c) a λnut L site; (d) a λN Shine-Dalgarno nucleotide sequence; (e) a translation start codon encoded by a λN gene amino-terminal fragment; (f) a cloning segment; (g) a lacZ gene carboxy-terminal fragment; and (h) an amplicillin-resistance marker.
Claim 31
Dependent Claim
87 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λP L promoter; (b) a λO L operator; (c) a λnut L site; (d) a λN Shine-Dalgarno nucleotide sequence; (e) a translation start codon encoded by a λN gene amino-terminal fragment; (f) a cloning segment; (g) a lacZ gene carboxy-terminal fragment; and (h) an amplicillin-resistance marker.
Claim 32
Dependent Claim
67 words
The DNA cloning and expression vector of claim 23, named pDH26, wherein the cloning segment comprises a BamHI site and is in the (0) translational phase, and which further includes a segment upstream of the λP L promoter which comprises from upstream to downstream: (a) a λP R promoter; (b) a λO R operator; (c) a λcI857 regulatory gene coding for repressor; and (d) a λrex gene.
Claim 33
Dependent Claim
76 words
The DNA cloning and expression vector of claim 23, named pDH36, wherein the cloning segment comprises a first BamHI site, a SmaI site and a second BamHI site and is in the (+1) translational phase, and which further includes a segment upstream of the λP L promoter which comprises from upstream to downstream: (a) a λP R promoter; (b) a λO R operator; (c) a λcI857 regulatory gene coding for repressor; and (d) a λrex gene.
Claim 34
Dependent Claim
34 words
The DNA cloning and expression vector of claim 23, named pDH72, wherein the cloning segment comprises a first BamHI, a SmaI site and a second BamHI site, and is in the (+1) translational phase.
Claim 35
Dependent Claim
66 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λP L promoter; (b) a λO L operator; (c) a cloning segment comprising a HindIII site; (d) a tetracycline-resistanee marker; and (e) an ampicillin-resistance marker.
Claim 36
Dependent Claim
66 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λP L promoter; (b) a λO L operator; (c) a cloning segment comprising a HindIII site; (d) a tetracycline-resistanee marker; and (e) an ampicillin-resistance marker.
Claim 37
Dependent Claim
19 words
The DNA cloning vector of claim 27, further comprising a λnutL sequence between the operator and the cloning segment.
Claim 38
Dependent Claim
95 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a lacZ and a λcro Shine-Dalgarno nucleotide sequence; (b) a translation start condon encoded by a λcro gene amino terminus fragment; (c) a cloning segment comprising a BglII site, a SmaI site and a BamHI site; (d) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (e) an ampicillin-resistance marker.
Claim 39
Dependent Claim
95 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a lacZ and a λcro Shine-Dalgarno nucleotide sequence; (b) a translation start condon encoded by a λcro gene amino terminus fragment; (c) a cloning segment comprising a BglII site, a SmaI site and a BamHI site; (d) a portion of the lacI gene fused to a lacZ gene carboxy-terminal fragment; and (e) an ampicillin-resistance marker.
Claim 40
Dependent Claim
32 words
The DNA cloning and expression vector of claim 29 which further comprises from upstream to downstream, upstream of the Shine-Dalgarno nucleotide sequence: (a) a λP L promoter (b) a λO L operator.
Claim 41
Dependent Claim
21 words
The DNA cloning and expression vector of claim 30 which further comprises a λnutL sequence downstream of the λO L operator.
Claim 42
Dependent Claim
41 words
The DNA cloning and expression vector of claim 30 which further comprises from upstream to downstream, upstream of the λP L promoter: (a) a λcI857 regulatory gene coding for repressor; (b) a λP R promoter; and (c) a λO R operator.
Claim 43
Dependent Claim
68 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λP L promoter; (b) a λnutL sequence; (c) a λN Shine-Dalgarno nucleotide sequence; (d) a λN gene comprising a unique HpaI site; and (e) an ampicillin-resistance marker.
Claim 44
Dependent Claim
68 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a λP L promoter; (b) a λnutL sequence; (c) a λN Shine-Dalgarno nucleotide sequence; (d) a λN gene comprising a unique HpaI site; and (e) an ampicillin-resistance marker.
Claim 45
Dependent Claim
26 words
The DNA cloning and expression vector of claim 33, named pDN55, which further comprises a SalI site just upstream of the P L -O L region.
Claim 46
Dependent Claim
93 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a partially deleted λP L -λO L promoter-operator region, consisting of the nucleotide sequence AAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGATACTGAGCACATCAG; (b) a λnut L sequence; (c) a λN Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a λN gene amino-terminal fragment; (e) a cloning segment; (f) a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 47
Dependent Claim
93 words
A DNA cloning and expression vector capable of incorporating a nucleic acid sequence and providing strong expression without further vector manipulation after ligation of the sequence and of propagating in a microbial host, which comprises from upstream to downstream: (a) a partially deleted λP L -λO L promoter-operator region, consisting of the nucleotide sequence AAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGATACTGAGCACATCAG; (b) a λnut L sequence; (c) a λN Shine-Dalgarno nucleotide sequence; (d) a translation start codon encoded by a λN gene amino-terminal fragment; (e) a cloning segment; (f) a lacZ gene carboxy-terminal fragment; and (g) an ampicillin-resistance marker.
Claim 48
Dependent Claim
26 words
The DNA cloning and expression vector of claim 33, named pDH428, wherein the cloning segment comprises a BamHI site and is in the (0) translational phase.
Claim 49
Dependent Claim
35 words
The DNA cloning and expression vector of claim 33, named pDH438, wherein the cloning segment comprises a first BamHI site, a SmaI site and a second BamHI site and is in the (+1) translational phase.
Claim 50
Dependent Claim
24 words
The DNA cloning and expression vector of claim 21, named pDNT456RI - , containing a unique EcoRI site upstream of the cI857 regulatory gene.
References Cited (Backward Citations)
US4237224A
Cited
GB1557774A
Cited
US4304863A
Cited
US4371625A
Cited
US4332892A
Cited
US4349629A
Cited
US4342832A
Cited
US4338397A
Cited
US4374927A
Cited
GB2100738A
Cited
US4436815A
Cited
US4503142A
Cited
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 1990-01-05 | 1990-07-07 | 1991-01-06 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 1994-01-05 | 1994-07-07 | 1995-01-06 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 1998-01-05 | 1998-07-07 | 1999-01-06 | $7700.00 | Window Closed / Lapsed |