EP0332424A2
Expired / Lapsed
EP
⏱️ 0.0 years remaining
Chimeric antibodies directed against human carcinoembryonic antigen
Assignee: Hybritech Inc
•
Filing: 1989-03-08
•
Granted: —
•
Expires: 2009-03-08
Abstract
Abstract The present invention discloses novel chimeric monoclonal antibodies, directed against human carcinoembryonic antigen, having antigen-specific variable regions of defined amino acid sequences. DNA constructs for the light and heavy chain variable regions comprising the novel antibodies of the invention are provided. Eukaryotic host cells capable of expression of the chimeric antibodies and comprising the novel chimeric antibody-encoding DNA constructs are also provided.
Inventors
- 👤 Catherine Brautigam Beidler
- 👤 Mary Jacqueline Johnson
- 👤 James Richard Ludwig
- 👤 Dennis J. Carlo
- 👤 Gary Samuel David
Bibliographic Details
Application Number
—
Jurisdiction
EP
Data Source
google_patents
Last Synchronized
2026-11-09 13:29
CPC Classifications
C; C12; C12N; C12N15/00; C12N15/09; C12N15/63; C12N15/79; C12N15/85; C07; C07K; C07K16/00; C07K16/18; C07K16/28; C07K16/30; C07K16/3007; C07K2317/00; C07K2317/20; C07K2317/24; C07K2319/00
Claims Analysis
Total Claims: 33
Claim 1
Independent Claim
239 words
A DNA construct comprising a first DNA sequence which encodes for the light chain variable region of a chimeric monoclonal antibody, the first DNA sequence coding for an amino acid sequence substantially the same as: Asp - Ile - Val - Met - Thr - Gln - Ser - Gln - Lys Phe - Met - Ser - Thr - Ser - Val - Gly - Asp - Arg Val - Ser - Ile - Thr - Cys - Lys - Ala - Ser - Gln Asn - Val - Arg - Thr - Ala - Val - Ala - Trp - Tyr Gln - Gln - Lys - Pro - Gly - Gln - Ser - Pro - Lys Ala - Leu - Ile - Tyr - Leu - Ala - Ser - Asn - Arg Tyr - Thr - Gly - Val - Pro - Asp - Arg - Phe - Thr Gly - Ser - Gly - Ser - Gly - Thr - Asp - Phe - Thr Leu - Thr - Ile - Thr - Asn - Val - Gln - Ser - Glu Asp - Leu - Ala - Asp - Tyr - Phe - Cys - Leu - Gln His - Trp - Asn - Tyr - Pro - Leu - Thr - Phe - Gly Ala - Gly - Thr - Lys - Leu - Glu - Leu - Lys - Arg.
Claim 2
Dependent Claim
239 words
A DNA construct comprising a first DNA sequence which encodes for the light chain variable region of a chimeric monoclonal antibody, the first DNA sequence coding for an amino acid sequence substantially the same as: Asp - Ile - Val - Met - Thr - Gln - Ser - Gln - Lys Phe - Met - Ser - Thr - Ser - Val - Gly - Asp - Arg Val - Ser - Ile - Thr - Cys - Lys - Ala - Ser - Gln Asn - Val - Arg - Thr - Ala - Val - Ala - Trp - Tyr Gln - Gln - Lys - Pro - Gly - Gln - Ser - Pro - Lys Ala - Leu - Ile - Tyr - Leu - Ala - Ser - Asn - Arg Tyr - Thr - Gly - Val - Pro - Asp - Arg - Phe - Thr Gly - Ser - Gly - Ser - Gly - Thr - Asp - Phe - Thr Leu - Thr - Ile - Thr - Asn - Val - Gln - Ser - Glu Asp - Leu - Ala - Asp - Tyr - Phe - Cys - Leu - Gln His - Trp - Asn - Tyr - Pro - Leu - Thr - Phe - Gly Ala - Gly - Thr - Lys - Leu - Glu - Leu - Lys - Arg.
Claim 3
Dependent Claim
223 words
The DNA construct according to Claim 1 wherein the first DNA strand coding sequence is substantially the same as: GAC - ATT - GTG - ATG - ACC - CAG - TCT - CAA - AAA TTC - ATG - TCC - ACA - TCA - GTA - GGA - GAC - AGG GTC - AGC - ATC - ACC - TGC - AAG - GCC - AGT - CAG AAT - GTT - CGT - ACT - GCT - GTT - GCC - TGG - TAT CAA - CAG - AAA - CCA - GGG - CAG - TCT - CCT - AAA GCA - CTG - ATT - TAC - TTG - GCA - TCC - AAC - CGG TAC - ACT - GGA - GTC - CCT - GAT - CGC - TTC - ACA GGC - AGT - GGA - TCT - GGG - ACA - GAT - TTC - ACT CTC - ACC - ATT - ACC - AAT - GTG - CAA - TCT - GAA GAC - CTG - GCA - GAT - TAT - TTC - TGT - CTG - CAA CAT - TGG - AAT - TAT - CCG - CTC - ACG - TTC - GGT GCT - GGG - ACC - AAG - CTG - GAG - CTG - AAA - CGG.
Claim 4
Dependent Claim
27 words
The DNA construct according to Claim 1 or 2 wherein the first DNA strand coding sequence further comprises a DNA sequence encoding for a eukaryotic leader peptide.
Claim 5
Dependent Claim
34 words
The DNA construct according to Claim 1, 2 or 3 wherein the DNA construct further comprises a second DNA strand sequence which encodes for the light chain constant region of the chimeric monoclonal antibody.
Claim 6
Dependent Claim
59 words
The DNA construct according to Claim 3 wherein the DNA strand sequence encoding for the leader peptide is substantially the same as: ATG - GAG - TTT - CAG - ACC - CAG - GTC - TTT - GTA TTC - GTG - TTG - CTC - TGG - TTG - TCT - GGT - GTT GAT - GGA.
Claim 7
Dependent Claim
265 words
A DNA construct comprising a first DNA sequence which encodes for the heavy chain variable region of a chimeric monoclonal antibody, the first DNA sequence coding for an amino acid sequence substantially the same as: Asp - Val - Gln - Leu - Val - Glu - Ser - Gly - Gly Gly - Leu - Val - Gln - Pro - Gly - Gly - Ser - Arg Lys - Leu - Ser - Cys - Ala - Ala - Ser - Gly - Phe Thr - Phe - Ser - Asn - Phe - Gly - Met - His - Trp Ile - Arg - Gln - Ala - Pro - Glu - Lys - Gly - Leu Glu - Trp - Val - Ala - Tyr - Ile - Ser - Gly - Gly Ser - Ser - Thr - Ile - Tyr - Tyr - Ala - Asp - Thr Val - Lys - Gly - Arg - Phe - Thr - Ile - Ser - Arg Asp - Asn - Pro - Arg - Asn - Thr - Leu - Phe - Leu Gln - Met - Thr - Ser - Leu - Arg - Ser - Glu - Asp Thr - Ala - Met - Phe - Tyr - Cys - Ala - Arg - Asp Tyr - Tyr - Ala - Asn - Asn - Tyr - Trp - Tyr - Phe Asp - Val - Trp - Gly - Ala - Gly - Thr - Thr - Val Thr - Val - Ser - Ser - Ala.
Claim 8
Dependent Claim
265 words
A DNA construct comprising a first DNA sequence which encodes for the heavy chain variable region of a chimeric monoclonal antibody, the first DNA sequence coding for an amino acid sequence substantially the same as: Asp - Val - Gln - Leu - Val - Glu - Ser - Gly - Gly Gly - Leu - Val - Gln - Pro - Gly - Gly - Ser - Arg Lys - Leu - Ser - Cys - Ala - Ala - Ser - Gly - Phe Thr - Phe - Ser - Asn - Phe - Gly - Met - His - Trp Ile - Arg - Gln - Ala - Pro - Glu - Lys - Gly - Leu Glu - Trp - Val - Ala - Tyr - Ile - Ser - Gly - Gly Ser - Ser - Thr - Ile - Tyr - Tyr - Ala - Asp - Thr Val - Lys - Gly - Arg - Phe - Thr - Ile - Ser - Arg Asp - Asn - Pro - Arg - Asn - Thr - Leu - Phe - Leu Gln - Met - Thr - Ser - Leu - Arg - Ser - Glu - Asp Thr - Ala - Met - Phe - Tyr - Cys - Ala - Arg - Asp Tyr - Tyr - Ala - Asn - Asn - Tyr - Trp - Tyr - Phe Asp - Val - Trp - Gly - Ala - Gly - Thr - Thr - Val Thr - Val - Ser - Ser - Ala.
Claim 9
Dependent Claim
249 words
The DNA construct according to Claim 6 wherein the first DNA strand coding sequence is substantially the same as: GAT - GTG - CAG - CTG - GTG - GAG - TCT - GGG - GGA GGC - TTA - GTG - CAG - CCT - GGA - GGG - TCC - CGG AAA - CTC - TCC - TGT - GCA - GCC - TCT - GGA - TTC ACT - TTC - AGT - AAC - TTT - GGA - ATG - CAC - TGG ATT - CGT - CAG - GCT - CCA - GAG - AAG - GGA - CTG GAG - TGG - GTC - GCA - TAC - ATT - AGT - GGT - GGC AGT - AGT - ACC - ATC - TAC - TAT - GCA - GAC - ACA GTG - AAG - GGC - CGA - TTC - ACC - ATC - TCC - AGA GAC - AAT - CCC - AGG - AAC - ACC - CTC - TTC - CTG CAA - ATG - ACC - AGT - CTA - AGG - TCT - GAG - GAC ACG - GCC - ATG - TTT - TAC - TGT - GCA - AGA - GAT TAC - TAC - GCT - AAC - AAC - TAC - TGG - TAC - TTC GAT - GTC - TGG - GGC - GCA - GGG - ACC - ACG - GTC ACC - GTC - TCC - TCA - GCC.
Claim 10
Dependent Claim
33 words
The DNA construct according to Claims 6 or 7 wherein the DNA construct further comprises a second DNA strand sequence which encodes for the heavy chain constant region of the chimeric monoclonal antibody.
Claim 11
Dependent Claim
25 words
The DNA construct according to Claim 6 wherein the first DNA strand coding sequences further comprises a DNA sequence encoding for a eukaryotic leader peptide.
Claim 12
Dependent Claim
58 words
The DNA construct according to Claim 9 wherein the DNA strand sequence encoding for the leader peptide is substantially the same as: ATG - GAC - TCC - AGG - CTC - AAT - TTA - GTT - TTC - CTT GTC - CTT - ATT - TTA - AAA - GGT - GTC - CAG - TGT.
Claim 13
Dependent Claim
24 words
The DNA construct according to any of Claims 1 to 10 wherein the first DNA strand coding sequence is derived from a murine hybridoma.
Claim 14
Dependent Claim
14 words
The DNA construct according to Claim 11 wherein the murine hybridoma is CEM 231.6.7.
Claim 15
Dependent Claim
22 words
The DNA construct according to Claim 4 or 8 wherein the second DNA strand coding sequence is derived from a human lymphocyte.
Claim 16
Dependent Claim
54 words
A eukaryotic host cell capable of expression of a chimeric monoclonal antibody comprising the DNA construct of any of Claims 1 to 5 encoding for the light chain of the chimeric antibody, and transcriptional and translational DNA sequences positioned in relation to the light chain-encoding DNA sequence to direct expression of the light chain.
Claim 17
Dependent Claim
62 words
The eukaryotic host cell according to Claim 17 wherein a second DNA construct comprises, or the first DNA construct further comprises, the construct of any of Claims 6 to 10 encoding for the heavy chain of the chimeric antibody, and transcriptional and translational DNA sequences positioned in relation to the heavy chain-encoding DNA strand sequence to direct expression of the heavy chain.
Claim 18
Dependent Claim
25 words
The DNA construct of Claim 1 or 2 that is plasmid pMLCE-10 as shown in Figure 1 or plasmid pHKCE-10 as shown in Figure 2.
Claim 19
Dependent Claim
15 words
The DNA construct of Claim 4 that is plasmid pGCEMK as shown in Figure 2.
Claim 20
Dependent Claim
22 words
The DNA construct of Claim 6 that is plasmid pMHCE-30 as shown in Figure 3 or pHGCEM-30 as shown in Figure 4.
Claim 21
Dependent Claim
15 words
The DNA construct of Claim 10 that is plasmid pNCEMG1 as shown in Figure 4.
Claim 22
Dependent Claim
72 words
A method of expressing chimeric antibodies which comprise the variable region of Claim 1 or 6 in transfected cells, said method comprising the steps of: a) constructing a recombinant DNA vector which comprises one or more genes encoding the variable region of Claim 1 or 6, b) transfecting said vector into a mammalian host cell, and c) culturing said host cell under conditions suitable for the expression of said variable region genes.
Claim 23
Dependent Claim
14 words
The method of Claim 20 wherein the DNA construct is plasmid pGCEMK or pNCEMG1.
Claim 24
Independent Claim
67 words
A method of increasing the expression of chimeric antibodies in transfected cells, said method comprising the steps of: a) constructing an SV40 vector-based recombinant DNA expression vector which comprises one or more genes encoding immunoglobulin chains, said vector lacking the SV40 enhancer, b) transfecting said vector into a mammalian host cell, and c) culturing said host cell under conditions suitable for the expression of said immunoglobulin genes.
Claim 25
Independent Claim
67 words
A method of increasing the expression of chimeric antibodies in transfected cells, said method comprising the steps of: a) constructing an SV40 vector-based recombinant DNA expression vector which comprises one or more genes encoding immunoglobulin chains, said vector lacking the SV40 enhancer, b) transfecting said vector into a mammalian host cell, and c) culturing said host cell under conditions suitable for the expression of said immunoglobulin genes.
Claim 26
Dependent Claim
39 words
The method of Claim 27 wherein the enhancerless vector is plasmid pGCEMK(E-) as described in Example 5C, plasmid pNCEMK(E-) as described in Example 5D, plasmid pGCEMG1(E-) as described in Example 5C, or plasmid pNCEMG1(E-) as described in Example 5D.
Claim 27
Dependent Claim
9 words
Plasmid pGCEMK(E-), plasmid pNCEMK(E-), plasmid pGCEMG1(E-) or, plasmid pNCEMG1(E-).
Claim 28
Dependent Claim
9 words
Plasmid pGCEMK(E-), plasmid pNCEMK(E-), plasmid pGCEMG1(E-) or, plasmid pNCEMG1(E-).
Claim 29
Dependent Claim
16 words
The approximately 2.2 kilobase Cla I/ Ssp I CEM kappa promoter-containing restriction fragment of plasmid pGCEMK.
Claim 30
Dependent Claim
16 words
The approximately 2.2 kilobase Cla I/ Ssp I CEM kappa promoter-containing restriction fragment of plasmid pGCEMK.
Claim 31
Dependent Claim
7 words
The CEM kappa promoter of plasmid pGCEMK.
Claim 32
Dependent Claim
7 words
The CEM kappa promoter of plasmid pGCEMK.
Claim 33
Dependent Claim
17 words
The CEM kappa promoter of Claim 26 wherein the nucleotide sequence comprises: CCCAATATCTGATTTTGATGGCAGCCTGTCATGAGAACATCTATAGACTTGTGGTTTCAGAGC TTTAAATTGGTCCTTGAGCTTCTATTTTGACTTCCTTCCCAGTGATTACTTCCTGTCTTTGGT AGTACTTTAGATTGTTTATTTAACCTGGATACTCTCAAACAGCTGTGTAATTTACTTCCTTAT TTGATGACTATTTTGCATAGATCCCTAGAGCCAGCACAGCTGCCCATGATTTATAAACCATGT CTTTGCAGTAGATCTAAAATACATCAGACCAGCATGGGCATCAAG
References Cited (Backward Citations)
No citation records indexed.
USPTO Annuity & Maintenance Windows
Maintenance schedule is calculated for granted US utility patents.