EP0305145A2
Expired / Lapsed
EP
⏱️ 0.0 years remaining
Methods and probes for detecting nucleic acids
Assignee: Ortho Clinical Diagnostics Inc
•
Filing: 1988-08-23
•
Granted: —
•
Expires: 2008-08-23
Abstract
Abstract An in solution hybridization method utilizes two soluble oligonucletide probes. One of the probes has a homopolynucleotide tail which is captured by a solid support coated with a complementary homopolynucleotide. A ribosomal RNA sequence specific to M. pneumoniae and synthetic probes complementary thereto are provided. Methods are provided for specifically identifying the presence of Mycoplasma pneumoniae 16S ribosomal RNA in a sample by using at least one synthetic nucleic acid probe complementary to the 16S ribosomal RNA in a hybridization assay. The methods comprise providing at least one synthetic probe which has a sequence complementary to at least a portion of a ribosomal RNA sequence specific to M. pneumoniae .
Inventors
- 👤 Robert A. Zivin
- 👤 John A. Monahan
Bibliographic Details
Application Number
—
Jurisdiction
EP
Data Source
google_patents
Last Synchronized
2026-11-03 11:32
CPC Classifications
C; C12; C12Q; C12Q1/00; C12Q1/68; C12Q1/6876; C12Q1/6888; C12Q1/689; C12Q1/6813
Claims Analysis
Total Claims: 13
Claim 1
Independent Claim
148 words
A method for determining the presence or amount of a target nucleic acid sequence in a sample suspected of containing said target, comprising: a) providing a soluble capture oligonucleotide complementary to at least a portion of the target sequence and a soluble detectable oligonucleotide complementary to a substantially different portion of the target sequence, wherein the capture oligonucleotide has a homopolynucleotide tail covalently attached thereto; b) mixing the capture oligonucleotide, detectable oligonucleotide and single stranded target nucleic acid in an aqueous solution under hybridizing conditions so as to form a soluble tripartite hybridization complex; c) contacting said tripartite complex with an insoluble solid support having homopolynucleotide tails covalently attached thereto, wherein the immobilized tails are complementary to the tail on the capture oligonucleotide, and wherein the tails hybridize thereby immobilizing said tripartite complex; and d) detecting or measuring the presence of the detectable oligonucleotide on said solid support.
Claim 2
Independent Claim
148 words
A method for determining the presence or amount of a target nucleic acid sequence in a sample suspected of containing said target, comprising: a) providing a soluble capture oligonucleotide complementary to at least a portion of the target sequence and a soluble detectable oligonucleotide complementary to a substantially different portion of the target sequence, wherein the capture oligonucleotide has a homopolynucleotide tail covalently attached thereto; b) mixing the capture oligonucleotide, detectable oligonucleotide and single stranded target nucleic acid in an aqueous solution under hybridizing conditions so as to form a soluble tripartite hybridization complex; c) contacting said tripartite complex with an insoluble solid support having homopolynucleotide tails covalently attached thereto, wherein the immobilized tails are complementary to the tail on the capture oligonucleotide, and wherein the tails hybridize thereby immobilizing said tripartite complex; and d) detecting or measuring the presence of the detectable oligonucleotide on said solid support.
Claim 3
Dependent Claim
25 words
The method of claim 1, wherein the capture and detectable oligonucleotides are at least 11 nucleotides long and optionally no more than 100 nucleotides long.
Claim 4
Dependent Claim
31 words
The method of claim 1 or claim 2, wherein the capture and detectable oligonucleotides are complementary to adjacent target sequences which either abut or are separated by one or more nucleotides.
Claim 5
Independent Claim
54 words
The method of any of claims 1 to 3, wherein the detectable oligonucleotide has at least one radioactive, fluorescent, chemiluminescent or other reporter molecule covalently attached thereto, and/or the detectable oligonucleotide has at least one detectable ligand covalently attached thereto, the ligand optionally being biotin, an enzyme, an antibody-specific antigen or an antigen-specific antibody.
Claim 6
Independent Claim
35 words
The method of any of the preceding claims, wherein the homopolynucleotide tails are poly A, poly G, poly C, poly T or poly U tails, the homopolynucleotide tails optionally being at least 50 nucleotides long.
Claim 7
Independent Claim
41 words
The method of any one of the preceding claims, wherein prior to or simultaneously with step (b), the sample is treated so as to lyse cells containing the target nucleic acid and to provide target nucleic acid in single stranded form.
Claim 8
Dependent Claim
93 words
In a method for identifying the presence of Mycoplasma pneumoniae 16S ribosomal RNA in a sample by using at least one nucleic acid probe complementary to the ribosomal RNA in a hybridization assay, the improvement comprising: providing at least one synthetic nucleic acid probe having a sequence complementary to at least a portion of the RNA sequence: 5′ ACCGCAUAAGAACUUUGGUUCGCAUGAA UCAAAGUUGAAAGGACCUGCAAGGGUUC GUUAUUUGAUGAGGGUGCGCCAUAUCAG CUAGUUGGUGGGGUAACGGCCUACCAAGGCA 3′ or providing at least one nucleic acid probe complementary to at least a portion of the RNA fragment of the 16S rRNA of M. pneumoniae having the above nucleotide sequence.
Claim 9
Dependent Claim
93 words
In a method for identifying the presence of Mycoplasma pneumoniae 16S ribosomal RNA in a sample by using at least one nucleic acid probe complementary to the ribosomal RNA in a hybridization assay, the improvement comprising: providing at least one synthetic nucleic acid probe having a sequence complementary to at least a portion of the RNA sequence: 5′ ACCGCAUAAGAACUUUGGUUCGCAUGAA UCAAAGUUGAAAGGACCUGCAAGGGUUC GUUAUUUGAUGAGGGUGCGCCAUAUCAG CUAGUUGGUGGGGUAACGGCCUACCAAGGCA 3′ or providing at least one nucleic acid probe complementary to at least a portion of the RNA fragment of the 16S rRNA of M. pneumoniae having the above nucleotide sequence.
Claim 10
Dependent Claim
49 words
In a method for identifying the presence of Mycoplasma pneumoniae 16S ribosomal RNA in a sample by using two different nucleic acid probes complementary to the ribosomal RNA in a one-step sandwich hybridization assay, the improvement comprising: providing first and second nucleic acid probes as defined in Claim 7.
Claim 11
Dependent Claim
47 words
The method of Claim 29, wherein the first and second probes: (a) have non-overlapping sequences, (b) overlap but also have non-overlapping sequences, (c) are adjacent sequences and wherein the sequences abut or are separated by one or more bases, or (d) each have at least ten bases.
Claim 12
Dependent Claim
30 words
The method of Claim 8 or Claim 9, wherein one of the probes has a detectable label attached and the other probe is immobilizable or immobilized to a solid support.
Claim 13
Independent Claim
38 words
The method of any of Claims 7 to 10, wherein the probe or one of the probes has the sequence: 3′ GTATTCTTGAAACCAAGCGTACTTA GTTTCAAC 5′, 3′ CTGGACGTTCCCAAGCAATAAACTA CTCCCACGCGGT 5′, 3′ CCAAGCGTACTTAGTTTCAACTTTCC 5′, 3′ TGGACGTTCCCAAGCAATAAACTACT 5′, or 3′ ATAGTCGATCAACCACCCCATTGCCGGATGGTTCCGT 5′.
References Cited (Backward Citations)
No citation records indexed.
USPTO Annuity & Maintenance Windows
Maintenance schedule is calculated for granted US utility patents.