EP0207044A1
Expired / Lapsed
EP
⏱️ 0.0 years remaining
Release of peptides from polypeptides
Assignee: Monsanto Co
•
Filing: 1986-06-16
•
Granted: —
•
Expires: 2006-06-16
Abstract
Abstract A method for obtaining heterologous peptides from fusion proteins wherein heterologous peptides include eucaryotic hormones such as atrial peptides. A novel DNA sequence encoding atrial peptide III. Various genes, DNA vectors, endopeptidases and transformed bacteria useful in practicing the method of the present invention.
Inventors
- 👤 Marilyn Sue Mai
- 👤 Michael Louis Bittner
- 👤 Sarah Ruth Braford
Bibliographic Details
Application Number
—
Jurisdiction
EP
Data Source
google_patents
Last Synchronized
2026-11-04 19:19
CPC Classifications
C; C07; C07K; C07K14/00; C07K14/435; C07K14/575; C07K14/58; C12; C12N; C12N15/00; C12N15/09; C12N15/11; C12N15/62; C07K2319/00; C07K2319/50; C07K2319/70; C07K2319/74; C07K2319/75
Claims Analysis
Total Claims: 77
Claim 1
Independent Claim
95 words
A method for producing a heterologous peptide which comprises the steps of expressing in bacteria genomic DNA encoding a fusion protein, said fusion protein comprising a heterologous peptide linked to an endogenous protein at a junction site, wherein both the endogenous protein and the junction site have an endopeptidase cleavage site; recovering said fusion protein; treating said fusion peptide with a suitable endopeptidase such that the endopeptidase cleavage site at said junction site is preferentially cleaved while the endopeptidase cleavage site in the endogenous protein is substantially intact, and obtaining therefrom said desired heterologous peptide.
Claim 2
Independent Claim
95 words
A method for producing a heterologous peptide which comprises the steps of expressing in bacteria genomic DNA encoding a fusion protein, said fusion protein comprising a heterologous peptide linked to an endogenous protein at a junction site, wherein both the endogenous protein and the junction site have an endopeptidase cleavage site; recovering said fusion protein; treating said fusion peptide with a suitable endopeptidase such that the endopeptidase cleavage site at said junction site is preferentially cleaved while the endopeptidase cleavage site in the endogenous protein is substantially intact, and obtaining therefrom said desired heterologous peptide.
Claim 3
Dependent Claim
16 words
The method of Claim 1 wherein said endogenous protein is a recA protein or fragment thereof.
Claim 4
Dependent Claim
13 words
The method of Claim 1 wherein said heterologous peptide is an atrial peptide.
Claim 5
Dependent Claim
26 words
The method of Claim 3 wherein said atrial peptide is selected from a group consisting of atrial peptide I, atrial peptide III and atrial peptide IV.
Claim 6
Dependent Claim
48 words
The method of Claim 1 wherein said endopeptidase cleavage site comprises a glutamic acid-X peptide bond wherein X is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine.
Claim 7
Dependent Claim
9 words
The method of Claim 5 wherein X is serine.
Claim 8
Dependent Claim
13 words
The method of Claim 5 or 6 wherein said endopeptidase is V8 protease.
Claim 9
Dependent Claim
13 words
The method of Claim 1 wherein said DNA is contained within a plasmid.
Claim 10
Dependent Claim
22 words
The method of Claim 8 wherein said plasmid is selected from the group consisting of pMON6152, pMON6154, pMON6159 and functional equivalents thereof.
Claim 11
Dependent Claim
25 words
The method of Claim 1 wherein said heterologous peptide contains an amino acid sequence essentially the same as that of a naturally occurring eucaryotic peptide.
Claim 12
Dependent Claim
14 words
The method of Claim 10 wherein said eucaryotic peptide has smooth muscle relaxant activity.
Claim 13
Dependent Claim
10 words
A heterologous peptide produced by the method of Claim 1.
Claim 14
Dependent Claim
28 words
A composition comprising an atrial peptide and containing from about 90% to about 99.5% of said peptide and from about 0.5% to about 10% protein native to bacteria.
Claim 15
Dependent Claim
28 words
A composition comprising an atrial peptide and containing from about 90% to about 99.5% of said peptide and from about 0.5% to about 10% protein native to bacteria.
Claim 16
Dependent Claim
14 words
A DNA sequence or fragment thereof, wherein the coding strand comprises 5'-TCCAGCTGTTTCG GCGGGAATCGATAGATCGGCGCCCAATCAGGCCTTGGGTGTAACTCTTT CCGTTAC-3'.
Claim 17
Dependent Claim
14 words
A DNA sequence or fragment thereof, wherein the coding strand comprises 5'-TCCAGCTGTTTCG GCGGGAATCGATAGATCGGCGCCCAATCAGGCCTTGGGTGTAACTCTTT CCGTTAC-3'.
Claim 18
Independent Claim
94 words
A method for producing an atrial peptide which comprises the steps of expressing in bacteria genomic DNA encoding a fusion protein, said fusion protein comprising an atrial peptide linked to an endogenous protein at a junction site, wherein both the endogenous protein and the junction site have an endopeptidase cleavage site; recovering said fusion protein; treating said fusion protein with a suitable endopeptidase such that the endopeptidase cleavage site at said junction site is preferentially cleaved while the endopeptidase cleavage site in the endogenous protein is substantially intact; and obtaining therefrom said atrial peptide.
Claim 19
Independent Claim
94 words
A method for producing an atrial peptide which comprises the steps of expressing in bacteria genomic DNA encoding a fusion protein, said fusion protein comprising an atrial peptide linked to an endogenous protein at a junction site, wherein both the endogenous protein and the junction site have an endopeptidase cleavage site; recovering said fusion protein; treating said fusion protein with a suitable endopeptidase such that the endopeptidase cleavage site at said junction site is preferentially cleaved while the endopeptidase cleavage site in the endogenous protein is substantially intact; and obtaining therefrom said atrial peptide.
Claim 20
Dependent Claim
16 words
The method of Claim 15 wherein said endogenous protein is a recA protein or fragment thereof.
Claim 21
Dependent Claim
48 words
The method of Claim 15 wherein said endopeptidase cleavage site comprises a glutamic acid-X peptide bond wherein X is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine.
Claim 22
Dependent Claim
9 words
The method of Claim 17 wherein X is serine.
Claim 23
Dependent Claim
13 words
The method of Claim 18 or 19 wherein said endopeptidase is V8 protease.
Claim 24
Dependent Claim
35 words
A gene comprising DNA encoding sequentially a promoter that functions in bacteria, a ribosome binding site, a recA protein or fragment thereof, a V8 protease trigger signal, a heterologous peptide and a translation stop signal.
Claim 25
Dependent Claim
35 words
A gene comprising DNA encoding sequentially a promoter that functions in bacteria, a ribosome binding site, a recA protein or fragment thereof, a V8 protease trigger signal, a heterologous peptide and a translation stop signal.
Claim 26
Dependent Claim
23 words
The gene of Claim 20 wherein the V8 protease trigger signal comprises a serine codon is immediately preceded by a glutamic acid codon.
Claim 27
Dependent Claim
13 words
The gene of Claim 20 wherein said heterologous peptide is an atrial peptide.
Claim 28
Dependent Claim
25 words
The gene of Claim 22 wherein said atrial peptide is selected from the group consisting of atrial peptide I, atrial peptide III and atrial IV.
Claim 29
Dependent Claim
23 words
A recombinant vector selected from the group consisting of a bacterial plasmid and a bacteriophage having inserted therein the gene of Claim 20.
Claim 30
Dependent Claim
12 words
A bacteria having the gene of Claim 20 in its genomic DNA.
Claim 31
Dependent Claim
26 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising an endopeptidase trigger signal and a peptide having smooth muscle relaxant activity.
Claim 32
Dependent Claim
26 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising an endopeptidase trigger signal and a peptide having smooth muscle relaxant activity.
Claim 33
Dependent Claim
13 words
A heterologous polypeptide of Claim 26 wherein said peptide is an atrial peptide.
Claim 34
Dependent Claim
13 words
A heterologous polypeptide of Claim 26 wherein the recA protein comprises 100% recA.
Claim 35
Dependent Claim
13 words
A method of Claim 1 wherein said bacteria is a gram negative bacteria.
Claim 36
Dependent Claim
13 words
A method of Claim 29 wherein said gram negative bacteria is E. coli.
Claim 37
Dependent Claim
24 words
A heterologous polypeptide of Claim 26 wherein the endopeptidase trigger signal is selected from a group consisting of V8 protease, factor Xa and thrombin.
Claim 38
Dependent Claim
15 words
A heterologous polypeptide of Claim 31 wherein the V8 protease trigger signal comprises glutamic acid.
Claim 39
Dependent Claim
14 words
A heterologous polypeptide of Claim 31 wherein the V8 protease trigger signal comprises Glu-Ser.
Claim 40
Dependent Claim
14 words
A heterologous polypeptide of Claim 31 wherein the factor Xa trigger signal comprises Glu-Gly-Arg.
Claim 41
Dependent Claim
13 words
A heterologous polypeptide of Claim 31 wherein the thrombin cleavage site comprises Arg-Ala-Leu-Leu-Ala-Gly-Pro-Arg.
Claim 42
Dependent Claim
13 words
A heterologous polypeptide of Claim 31 wherein the thrombin cleavage site comprises Gly-Pro-Arg.
Claim 43
Dependent Claim
21 words
A heterologous polypeptide of Claim 27 wherein the atrial peptide is selected from a group consisting of API, APIII and APIV.
Claim 44
Dependent Claim
20 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising a V8 trigger signal and APIII.
Claim 45
Dependent Claim
20 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising a V8 trigger signal and APIII.
Claim 46
Dependent Claim
14 words
A heterologous polypeptide of Claim 38 wherein the recA protein comprises about 100% recA.
Claim 47
Dependent Claim
21 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising a factor Xa trigger signal and APIII.
Claim 48
Dependent Claim
21 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising a factor Xa trigger signal and APIII.
Claim 49
Dependent Claim
14 words
A heterologous polypeptide of Claim 40 wherein the factor Xa trigger signal comprises Glu-Gly-Arg.
Claim 50
Dependent Claim
22 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising a thrombin cleavage site and an atrial peptide.
Claim 51
Dependent Claim
22 words
A heterologous polypeptide comprising a recA protein or portion thereof, a junction site comprising a thrombin cleavage site and an atrial peptide.
Claim 52
Dependent Claim
20 words
A heterologous polypeptide of Claim 42 wherein the atrial peptide is selected from a group consisting of APIII and APIV.
Claim 53
Dependent Claim
13 words
A heterologous polypeptide of Claim 42 wherein the thrombin trigger signal comprises Arg-Ala-Leu-Leu-Ala-Gly-Pro-Arg.
Claim 54
Dependent Claim
13 words
A heterologous polypeptide of Claim 42 wherein the thrombin trigger signal comprises Gly-Pro-Arg.
Claim 55
Independent Claim
71 words
A method for producing atrial peptides in gram negative bacteria comprising: a. causing expression of genomic DNA which expression results in the production of fusion protein comprising a recA protein or portion thereof, a junction site comprising an endonuclease trigger signal and an atrial peptide; b. isolating the fusion protein; c. cleaving the fusion protein with an endopeptidase which recognizes the endopeptidase trigger signal; and d. obtaining therefrom the atrial peptide.
Claim 56
Independent Claim
71 words
A method for producing atrial peptides in gram negative bacteria comprising: a. causing expression of genomic DNA which expression results in the production of fusion protein comprising a recA protein or portion thereof, a junction site comprising an endonuclease trigger signal and an atrial peptide; b. isolating the fusion protein; c. cleaving the fusion protein with an endopeptidase which recognizes the endopeptidase trigger signal; and d. obtaining therefrom the atrial peptide.
Claim 57
Dependent Claim
20 words
A method of Claim 46 wherein the atrial peptide is selected from a group consisting of API, APIII and APIV.
Claim 58
Dependent Claim
28 words
A method of Claim 46 wherein the endopeptidase trigger signal is selected from a group consisting of a V8 protease, a factor Xa and a thrombin trigger signal.
Claim 59
Dependent Claim
14 words
The method of Claim 46 wherein the V8 protease trigger signal comprises glutamic acid.
Claim 60
Dependent Claim
13 words
The method of Claim 46 wherein the V8 protease trigger signal comprises Glu-Ser.
Claim 61
Dependent Claim
13 words
The method of Claim 46 wherein the factor Xa trigger signal comprises Glu-Gly-Arg.
Claim 62
Dependent Claim
12 words
The method of Claim 46 wherein the thrombin trigger signal comprises Arg-Ala-Leu-Leu-Ala-Gly-Pro-Arg.
Claim 63
Dependent Claim
12 words
The method of Claim 46 wherein the thrombin trigger signal comprises Gly-Pro-Arg.
Claim 64
Dependent Claim
12 words
The method of Claim 46 wherein the recA protein comprises 100% recA.
Claim 65
Dependent Claim
13 words
The method of Claim 46 wherein the gram negative bacteria is E. coli.
Claim 66
Dependent Claim
5 words
An expression vector comprising pMON6163.
Claim 67
Dependent Claim
5 words
An expression vector comprising pMON6163.
Claim 68
Dependent Claim
5 words
An expression vector comprising pMON6164.
Claim 69
Dependent Claim
5 words
An expression vector comprising pMON6164.
Claim 70
Dependent Claim
5 words
An expression vector comprising pMON6160.
Claim 71
Dependent Claim
5 words
An expression vector comprising pMON6160.
Claim 72
Dependent Claim
5 words
An expression vector comprising pMON6166.
Claim 73
Dependent Claim
5 words
An expression vector comprising pMON6166.
Claim 74
Dependent Claim
7 words
A microorganism having ATCC accession number 53147.
Claim 75
Dependent Claim
7 words
A microorganism having ATCC accession number 53147.
Claim 76
Dependent Claim
5 words
An expression vector comprising pMON2790.
Claim 77
Dependent Claim
5 words
An expression vector comprising pMON2790.
References Cited (Backward Citations)
USPTO Annuity & Maintenance Windows
Maintenance schedule is calculated for granted US utility patents.